Bioinformatics

In its simplest form, a sequence record can be represented as a string of nucleotides with some basic tag or identifier. The most widely used of these simple formats is FASTA, originally introduced as part of the FASTA software suite developed by Lipman and Pearson (1985) that is described in detail in Chapter 3. This inherently simple format provides an easy way of handling primary data for both humans and computers, taking the following form.

>U54469.1 CGGTTGCTTGGGTTTTATAACATCAGTCAGTGACAGGCATTTCCAGAGTTGCCCTGTTCAACAATCGATA GCTGCCTTTGGCCACCAAAATCCCAAACTTAATTAAAGAATTAAATAATTCGAATAATAATTAAGCCCAG TAACCTACGCAGCTTGAGTGCGTAACCGATATCTAGTATACATTTCGATACATCGAAATCATGGTAGTGT TGGAGACGGAGAAGGTAAGACGATGATAGACGGCGAGCCGCATGGGTTCGATTTGCGCTGAGCCGTGGCA GGGAACAACAAAAACAGGGTTGTTGCACAAGAGGGGAGGCGATAGTCGAGCGGAAAAGAGTGCAGTTGGC

For brevity, only the first few lines of the sequence are shown. In the simplest incarnation of the FASTA format, the “greater than” character (>) designates the beginning of a new sequence record; this line is referred to as the definition line (commonly called the “def line”). A unique identifier – in this case, the accession.version number (U54469.1) – is followed by the nucleotide sequence, in either uppercase or lowercase letters, usually with 60 characters per line. The accession number is the number that is always associated with this sequence (and should be cited in publications), while the version number suffix allows users to easily determine whether they are looking at the most up-to-date record for a particular sequence. The version number suffix is incremented by one each time the sequence is updated.

Additional information can be included on the definition line to make this simple format a bit more informative, as follows.

>ENA|U54469|U54469.1 Drosophila melanogaster eukaryotic initiation factor 4E (eIF4E) gene, complete cds, alternatively spliced.

This modified FASTA definition line now has information on the source database (ENA), its accession.version number (U54469.1), and a short description of what biological entity is represented by the sequence.

As flatfiles represent the elementary unit of information within sequence databases and facilitate the interchange of information between these databases, it is important to understand what each individual field within the flatfile represents and what kinds of information can be found in varying parts of the record. While there are minor differences in flatfile formats, they can all be separated into three major parts: the header , containing information and descriptors pertaining to the entire record; the feature table , which provides relevant annotations to the sequence; and the sequence itself.

The header is the most database-specific part of the record. Here, we will use the ENA version of the record for discussion (shown in its entirety in Appendix 1.1), with the corresponding DDBJ and GenBank versions of the header appearing in Appendix 1.2. The first line of the record provides basic identifying information about the sequence contained in the record, appropriately named the ID line; this corresponds to the LOCUS line in DDBJ/GenBank.

ID U54469; SV 1; linear; genomic DNA; STD; INV; 2881 BP.

The accession number is shown on the ID line, followed by its sequence version (here, the first version, or SV 1). As this is SV 1, this is equivalent to writing U54469.1, as described above. This is then followed by the topology of the DNA molecule (linear) and the molecule type (genomic DNA). The next element represents the ENA data class for this sequence (STD, denoting a “standard” annotated and assembled sequence). Data classes are used to group sequence records within functional divisions, enabling users to query specific subsets of the database. A description of these functional divisions can be found in Box 1.1. Finally, the ID line presents the taxonomic division for the sequence of interest (INV, for invertebrate; see Internet Resources) and its length (2881 base pairs). The accession number will also be shown separately on the AC line that immediately follows the ID lines.

The organization of nucleotide sequence records into discrete functional types provides a way for users to query specific subsets of the records within these databases. In addition, knowledge that a particular sequence is from a given technique-oriented database allows users to interpret the data from the proper biological point of view. Several of these divisions are described below, and examples of each of these functional divisions (called “data classes” by ENA) can be found by following the example links listed on the ENA Data Formats page listed in the Internet Resources section of this chapter.

Following the ID line are one or more date lines (denoted by DT), indicating when the entry was first created or last updated. For our sequence of interest, the entry was originally created on May 19, 1996 and was last updated in ENA on June 23, 2017:

DT 19-MAY-1996 (Rel. 47, Created) DT 23-JUN-2017 (Rel. 133, Last updated, Version 5)

The release number in each line indicates the first quarterly release made after the entry was created or last updated. The version number for the entry appears on the second line and allows the user to determine easily whether they are looking at the most up-to-date record for a particular sequence. Please note that this is different from the accession.version format described above – while some element of the record may have changed, the sequence may have remained the same, so these two different types of version numbers may not always correspond to one another.