Bioinformatics

Здесь есть возможность читать онлайн «Bioinformatics» — ознакомительный отрывок электронной книги совершенно бесплатно, а после прочтения отрывка купить полную версию. В некоторых случаях можно слушать аудио, скачать через торрент в формате fb2 и присутствует краткое содержание. Жанр: unrecognised, на английском языке. Описание произведения, (предисловие) а так же отзывы посетителей доступны на портале библиотеки ЛибКат.

Bioinformatics: краткое содержание, описание и аннотация

Предлагаем к чтению аннотацию, описание, краткое содержание или предисловие (зависит от того, что написал сам автор книги «Bioinformatics»). Если вы не нашли необходимую информацию о книге — напишите в комментариях, мы постараемся отыскать её.

Praise for the third edition of
“This book is a gem to read and use in practice.”
— "This volume has a distinctive, special value as it offers an unrivalled level of details and unique expert insights from the leading computational biologists, including the very creators of popular bioinformatics tools."
— “A valuable survey of this fascinating field. . . I found it to be the most useful book on bioinformatics that I have seen and recommend it very highly.”
— “This should be on the bookshelf of every molecular biologist.”
— The field of bioinformatics is advancing at a remarkable rate. With the development of new analytical techniques that make use of the latest advances in machine learning and data science, today’s biologists are gaining fantastic new insights into the natural world’s most complex systems. These rapidly progressing innovations can, however, be difficult to keep pace with.
The expanded fourth edition of the best-selling
aims to remedy this by providing students and professionals alike with a comprehensive survey of the current field. Revised to reflect recent advances in computational biology, it offers practical instruction on the gathering, analysis, and interpretation of data, as well as explanations of the most powerful algorithms presently used for biological discovery.
offers the most readable, up-to-date, and thorough introduction to the field for biologists at all levels, covering both key concepts that have stood the test of time and the new and important developments driving this fast-moving discipline forwards.
This new edition features: 
New chapters on metabolomics, population genetics, metagenomics and microbial community analysis, and translational bioinformatics A thorough treatment of statistical methods as applied to biological data Special topic boxes and appendices highlighting experimental strategies and advanced concepts Annotated reference lists, comprehensive lists of relevant web resources, and an extensive glossary of commonly used terms in bioinformatics, genomics, and proteomics
is an indispensable companion for researchers, instructors, and students of all levels in molecular biology and computational biology, as well as investigators involved in genomics, clinical research, proteomics, and related fields.

Bioinformatics — читать онлайн ознакомительный отрывок

Ниже представлен текст книги, разбитый по страницам. Система сохранения места последней прочитанной страницы, позволяет с удобством читать онлайн бесплатно книгу «Bioinformatics», без необходимости каждый раз заново искать на чём Вы остановились. Поставьте закладку, и сможете в любой момент перейти на страницу, на которой закончили чтение.

Тёмная тема
Сбросить

Интервал:

Закладка:

Сделать

In its simplest form, a sequence record can be represented as a string of nucleotides with some basic tag or identifier. The most widely used of these simple formats is FASTA, originally introduced as part of the FASTA software suite developed by Lipman and Pearson (1985) that is described in detail in Chapter 3. This inherently simple format provides an easy way of handling primary data for both humans and computers, taking the following form.

>U54469.1 CGGTTGCTTGGGTTTTATAACATCAGTCAGTGACAGGCATTTCCAGAGTTGCCCTGTTCAACAATCGATA GCTGCCTTTGGCCACCAAAATCCCAAACTTAATTAAAGAATTAAATAATTCGAATAATAATTAAGCCCAG TAACCTACGCAGCTTGAGTGCGTAACCGATATCTAGTATACATTTCGATACATCGAAATCATGGTAGTGT TGGAGACGGAGAAGGTAAGACGATGATAGACGGCGAGCCGCATGGGTTCGATTTGCGCTGAGCCGTGGCA GGGAACAACAAAAACAGGGTTGTTGCACAAGAGGGGAGGCGATAGTCGAGCGGAAAAGAGTGCAGTTGGC

For brevity, only the first few lines of the sequence are shown. In the simplest incarnation of the FASTA format, the “greater than” character (>) designates the beginning of a new sequence record; this line is referred to as the definition line (commonly called the “def line”). A unique identifier – in this case, the accession.version number (U54469.1) – is followed by the nucleotide sequence, in either uppercase or lowercase letters, usually with 60 characters per line. The accession number is the number that is always associated with this sequence (and should be cited in publications), while the version number suffix allows users to easily determine whether they are looking at the most up-to-date record for a particular sequence. The version number suffix is incremented by one each time the sequence is updated.

Additional information can be included on the definition line to make this simple format a bit more informative, as follows.

>ENA|U54469|U54469.1 Drosophila melanogaster eukaryotic initiation factor 4E (eIF4E) gene, complete cds, alternatively spliced.

This modified FASTA definition line now has information on the source database (ENA), its accession.version number (U54469.1), and a short description of what biological entity is represented by the sequence.

Nucleotide Sequence Flatfiles: A Dissection

As flatfiles represent the elementary unit of information within sequence databases and facilitate the interchange of information between these databases, it is important to understand what each individual field within the flatfile represents and what kinds of information can be found in varying parts of the record. While there are minor differences in flatfile formats, they can all be separated into three major parts: the header , containing information and descriptors pertaining to the entire record; the feature table , which provides relevant annotations to the sequence; and the sequence itself.

The Header

The header is the most database-specific part of the record. Here, we will use the ENA version of the record for discussion (shown in its entirety in Appendix 1.1), with the corresponding DDBJ and GenBank versions of the header appearing in Appendix 1.2. The first line of the record provides basic identifying information about the sequence contained in the record, appropriately named the ID line; this corresponds to the LOCUS line in DDBJ/GenBank.

ID U54469; SV 1; linear; genomic DNA; STD; INV; 2881 BP.

The accession number is shown on the ID line, followed by its sequence version (here, the first version, or SV 1). As this is SV 1, this is equivalent to writing U54469.1, as described above. This is then followed by the topology of the DNA molecule (linear) and the molecule type (genomic DNA). The next element represents the ENA data class for this sequence (STD, denoting a “standard” annotated and assembled sequence). Data classes are used to group sequence records within functional divisions, enabling users to query specific subsets of the database. A description of these functional divisions can be found in Box 1.1. Finally, the ID line presents the taxonomic division for the sequence of interest (INV, for invertebrate; see Internet Resources) and its length (2881 base pairs). The accession number will also be shown separately on the AC line that immediately follows the ID lines.

Box 1.1Functional Divisions in Nucleotide Databases

The organization of nucleotide sequence records into discrete functional types provides a way for users to query specific subsets of the records within these databases. In addition, knowledge that a particular sequence is from a given technique-oriented database allows users to interpret the data from the proper biological point of view. Several of these divisions are described below, and examples of each of these functional divisions (called “data classes” by ENA) can be found by following the example links listed on the ENA Data Formats page listed in the Internet Resources section of this chapter.

CON Constructed (or “contigged”) records of chromosomes, genomes, and other long DNA sequences resulting from whole -genome sequencing efforts. The records in this division do not contain sequence data; rather, they contain instructions for the assembly of sequence data found within multiple database records.
EST Expressed Sequence Tags. These records contain short (300–500 bp) single reads from mRNA (cDNA) that are usually produced in large numbers. ESTs represent a snapshot of what is expressed in a given tissue or at a given developmental stage. They represent tags – some coding, some not – of expression for a given cDNA library.
GSS Genome Survey Sequences. Similar to the EST division, except that the sequences are genomic in origin. The GSS division contains (but is not limited to) single-pass read genome survey sequences, bacterial artificial chromosome (BAC) or yeast artificial chromosome (YAC) ends, exon-trapped genomic sequences, and Alu polymerase chain reaction (PCR) sequences.
HTG High-Throughput Genome sequences. Unfinished DNA sequences generated by high-throughput sequencing centers, made available in an expedited fashion to the scientific community for homology and similarity searches. Entries in this division contain keywords indicating its phase within the sequencing process. Once finished, HTG sequences are moved into the appropriate database taxonomic division.
STD A record containing a standard, annotated, and assembled sequence.
STS Sequence-Tagged Sites. Short (200–500 bp) operationally unique sequences that identify a combination of primer pairs used in a PCR assay, generating a reagent that maps to a single position within the genome. The STS division is intended to facilitate cross-comparison of STSs with sequences in other divisions for the purpose of correlating map positions of anonymous sequences with known genes.
WGS Whole-Genome Shotgun sequences. Sequence data from projects using shotgun approaches that generate large numbers of short sequence reads that can then be assembled by computer algorithms into sequence contigs, higher -order scaffolds, and sometimes into near-chromosome- or chromosome-length sequences.

Following the ID line are one or more date lines (denoted by DT), indicating when the entry was first created or last updated. For our sequence of interest, the entry was originally created on May 19, 1996 and was last updated in ENA on June 23, 2017:

DT 19-MAY-1996 (Rel. 47, Created) DT 23-JUN-2017 (Rel. 133, Last updated, Version 5)

The release number in each line indicates the first quarterly release made after the entry was created or last updated. The version number for the entry appears on the second line and allows the user to determine easily whether they are looking at the most up-to-date record for a particular sequence. Please note that this is different from the accession.version format described above – while some element of the record may have changed, the sequence may have remained the same, so these two different types of version numbers may not always correspond to one another.

Читать дальше
Тёмная тема
Сбросить

Интервал:

Закладка:

Сделать

Похожие книги на «Bioinformatics»

Представляем Вашему вниманию похожие книги на «Bioinformatics» списком для выбора. Мы отобрали схожую по названию и смыслу литературу в надежде предоставить читателям больше вариантов отыскать новые, интересные, ещё непрочитанные произведения.


Bioinformatics and Medical Applications
Неизвестный Автор
Computation in BioInformatics
Неизвестный Автор
Data Analytics in Bioinformatics
Неизвестный Автор
Отзывы о книге «Bioinformatics»

Обсуждение, отзывы о книге «Bioinformatics» и просто собственные мнения читателей. Оставьте ваши комментарии, напишите, что Вы думаете о произведении, его смысле или главных героях. Укажите что конкретно понравилось, а что нет, и почему Вы так считаете.