Adam Sachs - Inherited Disorders - Stories, Parables & Problems

Здесь есть возможность читать онлайн «Adam Sachs - Inherited Disorders - Stories, Parables & Problems» весь текст электронной книги совершенно бесплатно (целиком полную версию без сокращений). В некоторых случаях можно слушать аудио, скачать через торрент в формате fb2 и присутствует краткое содержание. Год выпуска: 2016, Издательство: Regan Arts, Жанр: Современная проза, на английском языке. Описание произведения, (предисловие) а так же отзывы посетителей доступны на портале библиотеки ЛибКат.

Inherited Disorders: Stories, Parables & Problems: краткое содержание, описание и аннотация

Предлагаем к чтению аннотацию, описание, краткое содержание или предисловие (зависит от того, что написал сам автор книги «Inherited Disorders: Stories, Parables & Problems»). Если вы не нашли необходимую информацию о книге — напишите в комментариях, мы постараемся отыскать её.

A son receives an inheritance from his father and tries to dispose of it before it destroys him.
tells this elemental story in over 100 hilarious, witty variations. Adam Ehrlich Sachs’s
is a rueful, absurd, and endlessly entertaining look at a most serious subject — the eternally vexed relations between fathers and sons. In a hundred and seventeen shrewd, surreal vignettes, Sachs lays bare the petty rivalries, thwarted affection, and mutual bafflement that have characterized the filial bond since the days of Davidic kings. A philosopher’s son kills his father and explains his aphorisms to death. A father bequeaths to his son his jacket, deodorant, and political beliefs. England’s most famous medium becomes possessed by the spirit of his skeptical father — who questions, in front of the nation, his son’s choice of career. A Czech pianist amputates his fingers one by one to thwart his father, who will not stop composing concertos for him. A nineteenth-century Italian nobleman wills his ill-conceived flying contraption — incapable of actual flight — to his newborn son. In West Hollywood, an aspiring screenwriter must contend with the judgmental visage of his father, a respected public intellectual whose frozen head, clearly disappointed in him, he keeps in his freezer. Keenly inventive, but painfully familiar, these surprisingly tender stories signal the arrival of a brilliant new comic voice — and fresh hope for fathers and sons the world over.

Inherited Disorders: Stories, Parables & Problems — читать онлайн бесплатно полную книгу (весь текст) целиком

Ниже представлен текст книги, разбитый по страницам. Система сохранения места последней прочитанной страницы, позволяет с удобством читать онлайн бесплатно книгу «Inherited Disorders: Stories, Parables & Problems», без необходимости каждый раз заново искать на чём Вы остановились. Поставьте закладку, и сможете в любой момент перейти на страницу, на которой закончили чтение.

Тёмная тема
Сбросить

Интервал:

Закладка:

Сделать

As a result of these precautions, no one accuses the young director of nepotism, the way they do Sofia Coppola.

8: OUR SYSTEM

…………………….

A philosopher had spent his lifetime pondering the nature of knowledge and was ready at long last to write down his conclusions. He took out a sheet of white paper and a pen. But he noticed, upon lifting the pen, a slight tremor in his hand. Hours later he was diagnosed with a neuromuscular disorder that promptly began ravaging his body, though apparently, according to the doctor, not his mind.

He lost the use of his muscles one by one: first in his fingers, then in his toes, then in his arms, then in his legs. Soon he could only whisper weakly and twitch his right eyelid. Just before losing the power of speech entirely, he designed with his son’s help a system by which he could communicate, through twitches and blinks, the letters of the alphabet.

Then the philosopher fell silent.

He and his son embarked laboriously upon the writing of his book on knowledge. The father blinked or twitched his right eyelid; the son wrote down the corresponding letter. Progress was extraordinarily slow. After twenty years, they had written one hundred pages. Then, one morning, when the son picked up the pen, he noticed a slight tremor in his hand. He was diagnosed with the same neuromuscular disorder as his father — it was, naturally, hereditary — and began losing the use of his muscles, too. Soon he could only whisper weakly and manipulate his tongue. He and his own son designed a system with which he could communicate, by tapping his teeth with his tongue, the letters of the alphabet, and then he, too, fell silent.

The writing continued, though the pace, already indescribably slow, slowed even further. The grandfather blinked or twitched his right eyelid, his son tapped a tooth with his tongue, and the grandson wrote down the corresponding letter. After another twenty years, they had written another ten pages on the nature of knowledge.

One morning, the grandson noticed a slight tremor in his hand. He knew instantly what it meant. He did not even bother getting the diagnosis. His final surviving muscle was his left eyebrow, and by raising or lowering it just so he could communicate letters to his son. Again the pace slowed by an order of magnitude. The opportunities for error multiplied. Then his son was stricken, then his son’s son, then his son’s son’s son, and then his son’s son’s son’s son, who is my father.

We cram into our ancestral sickroom. It is dark and cold: we keep the blinds lowered and the heat down due to our hereditary light sensitivity and our hereditary heat intolerance, both of which are in fact unrelated to our hereditary neuromuscular disorder.

Someone tries to cough, but cannot. I sit at the desk and await the next letter, which can take months to arrive. The philosopher blinks or twitches his right eyelid; his son taps a tooth with his tongue; his son raises or lowers his left eyebrow; his son sucks on his upper or lower lip; his son flares a nostril; my grandfather blinks or twitches his left eyelid; my father taps a tooth with his tongue; and I write down the letter. Over the past eleven years I’ve written down the following:

CCCONCEPPTCCCCCAAAAACCCCCCCCCCPPCCCCCCPCCCCCCCPCCCCCCC

What to make of this? Perhaps the philosopher has lost his mind. Perhaps there’s been a disruption in our system of twitches and blinks and tooth-tapping and lip-sucking by which a letter is transmitted from his head to my pen. Perhaps — I certainly don’t rule this out! — I have lost my mind; perhaps no matter what my father taps I see only c’ s, and the occasional p . Or perhaps our system works perfectly, our philosopher’s mind works perfectly, his theory of knowledge reaches the page just as he intends it, and I simply do not have the wherewithal to understand it. That, too, cannot be ruled out.

A letter is now coming my way. The old men grimace and suck, twitch and tap, blink and blow. My son, here to watch, looks on with pity and terror, still not sure how all this relates to him. He hates being in this room. You should see how eagerly at the end of the day he kisses his ancestors and races out ahead of me into the hall.

9: TURIN, 1962

…………………….

Last year a Russian performance artist by the name of Pavlensky nailed his scrotum to the cobblestones of Red Square in Moscow to protest the supposed “perversity” of Russian society. From prison, he told the journal Artforum that he was inspired by the “absurdities of the Russian government.” When asked if he was inspired by other artists as well, Pavlensky said no, he was inspired only by reality. What about Hedegaard? asked the appropriately skeptical Artforum interviewer, but Pavlensky claimed never to have heard of the important Danish scrotum-nailer, who has been nailing his scrotum to objects and surfaces for more than forty years.

Pavlensky is not the first or last artist to efface his influences, but those of us who follow contemporary art were galled that he would deny even knowing about Hedegaard, who just recently nailed to much acclaim his scrotum to the wing of a jumbo jet in Paris.

Eventually we were able to prove conclusively that Pavlensky did attend a 1993 exhibition in Helsinki at which Hedegaard nailed his scrotum to the hood of a car. When presented with this evidence, Pavlensky said he did not recall Hedegaard’s performance, and then launched into a diversionary jeremiad against the centrality of oil money to Russian politics.

Reached by Artforum at his workshop in Copenhagen, where he was preparing a small piece called Scrotum on Steel, Hedegaard was remarkably gracious. First of all, he said, our work is very different. His is political, mine is not. Second, he said, I would not be who I am, I would not do what I do, if I had not seen Moretti staple his testicles to a fence post in Turin, 1962. We all come from somewhere, he said.

Hedegaard and Pavlensky, who was released from prison not long ago, are now rumored to be planning a joint exhibition. We do not know for certain to what they will be nailing their scrota, but they have reportedly rented a vast warehouse on the outskirts of Stuttgart.

10: CONCERTO FOR A CORPSE

…………………….

Probably no pianist in history has suffered as devastating a sequence of calamities as befell Pavel Hronek, the brilliant doomed Czech.

Just months after debuting to great acclaim with his father’s Concerto in B Minor, Hronek lost the pinky finger of his right hand in what he described as an eating incident at a Prague restaurant. Critics declared his career over; Hronek himself announced his retirement. Yet less than a year later he made a glorious return with his father’s Concerto for Nine Fingers.

His fame now was even greater than before. He crisscrossed the continent, played before kings and prime ministers. But in 1911, at a Parisian brasserie, he suffered another eating incident and lost the index finger of his left hand.

There is no coming back from this one, critics said.

“I am done!” Hronek bellowed at the journalists who crowded in the stairwell of his apartment building. “I am finished! Leave me alone!”

The very next year, of course, came his stunning performance of the Concerto for Eight Fingers, composed by his father.

Soon World War I loomed. With his mutilated hands and his cultural prestige, Hronek was clearly of more use to the Austro-Hungarian Empire in concert halls than on battlefields. Not only was he not drafted, he was actively discouraged from enlisting. But for reasons that musicologists continue to debate, Hronek insisted on joining the army anyway.

Читать дальше
Тёмная тема
Сбросить

Интервал:

Закладка:

Сделать

Похожие книги на «Inherited Disorders: Stories, Parables & Problems»

Представляем Вашему вниманию похожие книги на «Inherited Disorders: Stories, Parables & Problems» списком для выбора. Мы отобрали схожую по названию и смыслу литературу в надежде предоставить читателям больше вариантов отыскать новые, интересные, ещё непрочитанные произведения.


Отзывы о книге «Inherited Disorders: Stories, Parables & Problems»

Обсуждение, отзывы о книге «Inherited Disorders: Stories, Parables & Problems» и просто собственные мнения читателей. Оставьте ваши комментарии, напишите, что Вы думаете о произведении, его смысле или главных героях. Укажите что конкретно понравилось, а что нет, и почему Вы так считаете.