Kojo Suzuki - Spiral
Здесь есть возможность читать онлайн «Kojo Suzuki - Spiral» — ознакомительный отрывок электронной книги совершенно бесплатно, а после прочтения отрывка купить полную версию. В некоторых случаях можно слушать аудио, скачать через торрент в формате fb2 и присутствует краткое содержание. Год выпуска: 2007, ISBN: 2007, Издательство: Harper, Жанр: Ужасы и Мистика, на английском языке. Описание произведения, (предисловие) а так же отзывы посетителей доступны на портале библиотеки ЛибКат.
- Название:Spiral
- Автор:
- Издательство:Harper
- Жанр:
- Год:2007
- ISBN:9780007240142
- Рейтинг книги:4 / 5. Голосов: 1
-
Избранное:Добавить в избранное
- Отзывы:
-
Ваша оценка:
- 80
- 1
- 2
- 3
- 4
- 5
Spiral: краткое содержание, описание и аннотация
Предлагаем к чтению аннотацию, описание, краткое содержание или предисловие (зависит от того, что написал сам автор книги «Spiral»). Если вы не нашли необходимую информацию о книге — напишите в комментариях, мы постараемся отыскать её.
Spiral — читать онлайн ознакомительный отрывок
Ниже представлен текст книги, разбитый по страницам. Система сохранения места последней прочитанной страницы, позволяет с удобством читать онлайн бесплатно книгу «Spiral», без необходимости каждый раз заново искать на чём Вы остановились. Поставьте закладку, и сможете в любой момент перейти на страницу, на которой закончили чтение.
Интервал:
Закладка:
Sunday, October 21
The nature of a virus is to reproduce itself.
The charm: make a copy of the video.
What Asakawa meant here had to be none other than the smallpox virus. Just before her death, Sadako Yamamura had had physical relations with the last smallpox victim in Japan, Jotaro Nagao. It was natural to assume that the virus had invaded her body. Driven to the brink of extinction, the smallpox virus had borrowed Sadako’s extraordinary power to accomplish the purpose of its existence, which was to reproduce itself. But once it took the form of a videotape, the virus couldn’t” reproduce on its own. It had to work through human beings, forcing them to make copies of it. If one were to fill in the missing part at the end of the tape, it would run like this:
Those who have viewed these images are fated to die at this exact hour one week from now. If you do not wish to die, you must follow these instructions exactly. Make a copy of this videotape and show it to someone else.
In that light, things made sense. The day after he’d watched the videotape, Asakawa showed it to Ryuji, and he also made a copy for him. Without realizing it, he’d helped the virus propagate. But Ryuji never made a copy.
Sure he had the answer, Asakawa had loaded a VCR into the rented car and driven off somewhere. Undoubtedly he’d planned to make two copies of the video and show them to two other people-one for his wife, and one for his baby girl. The people he showed it to would then have to find new prey, someone else to give a copy of the video to. But that wasn’t the immediate problem. The important thing was to save the lives of his wife and child.
But just at the height of his relief at having saved the lives of his loved ones, Asakawa had reached into the back seat and touched his wife and daughter and found them cold. He lost control of the car.
Ando felt he could understand Asakawa’s catatonic state now. Not only was he devastated at the loss of his family, but he was no doubt also tormented by a question: what was the true nature of the charm? Every time he thought he had it figured out, the answer slipped through his fingers, transforming itself, claiming another life. Rage and sorrow, and an endless repetition of the question: Why? Why was he still alive?
Ando put the manuscript pages in a pile on the table. Then he asked himself: Do you really believe this cock-and-bull story?
He shook his head.
I just don’t know.
He didn’t know what else to say. He’d seen the unnatural sarcoma on Ryuji’s coronary artery with his own eyes. Seven people were dead of the same cause. In their blood had been found a virus that closely resembled smallpox. And where had Mai disappeared to? What about that odd ambience in her apartment, which she had seemingly vacated? That hair-raising intimation he’d had that something was there? The traces left on the videotape still in her VCR? Was the tape still propagating? Would it continue to claim new victims? The more he thought, the more questions Ando had.
He turned off the word processor and reached for the whiskey on the sideboard. He knew he wouldn’t be able to sleep tonight without the help of alcohol.
12
Ando first dropped by the biochem lab and returned the word processor to Ueda, and then headed to the Pathology Department. Under his arm he carried the report he’d printed out the night before. He intended to let Miyashita read it.
Miyashita sat with his head down low to the table, scratching away with a ballpoint pen. Ando dropped the report on the tabletop next to him, and Miyashita looked up in surprise.
“Listen, would you do me a favor and read this?”
Miyashita just stared back at Ando in amazement.
“What’s going on?”
“I want to know what you think of that.”
Miyashita picked up the document. “It’s pretty long.”
“It is, but there are things in there that will interest you. It won’t take long to read.”
“You’re not about to tell me you’ve been writing a novel in your spare time, are you?”
“Kazuyuki Asakawa wrote up a report about the deaths.”
“You mean, our Asakawa?”
“Right.”
Miyashita looked interested now as he flipped through some of the pages. “Hmm.”
“So, there it is. Let me know what you think when you’re done.”
Ando started to leave, but Miyashita called him back. “Hold on a minute.”
“What?”
Miyashita rested his cheek on his hand and tapped the table with the tip of his pen. “You’re pretty good at codes, aren’t you?”
“I wouldn’t say I’m particularly good at them. In med school, some friends of mine played around with them, but that’s about it.”
“Hmm,” said Miyashita, still tapping on the table.
“Why?”
Miyashita took his elbow off the printout he’d been looking at and slid it over to Ando. “This is why.” He started tapping his pen on the center of the page. It was the printout he’d seen the day before, the results of sequencing the virus found in Ryuji’s blood.
“You showed me this yesterday.”
“I know, but I just can’t get over it.”
Ando picked up the piece of paper and held it up in front of his face. Into several points in an otherwise unordered sequence of bases, a string of bases in the same order had been inserted.
ATGGAAGAAGAATATCGTTATATTCCTC CTCCTCAACAACAA
No question, it was strange for the same string of forty-two bases to appear several times at appropriate intervals.
“And Ryuji’s virus is the only one like this?”
“Right. His is the only one with these extra forty-two bases,” Miyashita said, his gaze not wavering from Ando’s. “Doesn’t that strike you as weird?”
“Of course it does.”
The tap-tap of the ballpoint pen ceased.
“The thought crossed my mind that it might be a sort of code.”
Ando gulped. He couldn’t remember having told Miyashita anything about what had happened after Ryuji’s autopsy. Not about the corner of newspaper, and certainly not about the fact that he’d come up with the word “ring” from it. And yet now Miyashita was talking about codes.
“Assuming it is a code, who’s sending it?”
“Ryuji.”
Ando screwed his eyes shut. The idea was one he’d been desperately trying to avoid entertaining, and now Miyashita was shoving it in his face.
“Ryuji’s dead. I performed the autopsy myself.”
Miyashita didn’t seem fazed in the least. “Well, whatever. Just see if you can decipher this, okay?”
Was it really possible that the sequence of bases could be somehow turned into a word? Just as the digits 178136 had quickly yielded RING, maybe these forty-two letters could be made to form words. Maybe they did carry some important message. Had Ryuji himself, from beyond the grave, inscribed this over and over in his own remains?
Ando’s hand, clutching the printout, trembled as he felt himself being driven into the same blind alley as Asakawa. But there was no way he could refuse Miyashita’s outright request. The idea that it might be a code had occurred to Ando, too, the first time he’d seen the sequence, but he’d buried the thought in the depths of his brain. He was afraid that if he didn’t, the scientific framework on which he’d hung his life would be bent further out of shape. Things were threatening to go beyond his ability to absorb them.
“You can keep that. Take your time and see what you can do with it.”
Miyashita was supposed to be a scientist. Ando couldn’t understand how he could bandy about these unscientific ideas so readily.
“I have faith in you. You’ll figure it out,” said Miyashita, giving Ando a pat on the butt.
Читать дальшеИнтервал:
Закладка:
Похожие книги на «Spiral»
Представляем Вашему вниманию похожие книги на «Spiral» списком для выбора. Мы отобрали схожую по названию и смыслу литературу в надежде предоставить читателям больше вариантов отыскать новые, интересные, ещё непрочитанные произведения.
Обсуждение, отзывы о книге «Spiral» и просто собственные мнения читателей. Оставьте ваши комментарии, напишите, что Вы думаете о произведении, его смысле или главных героях. Укажите что конкретно понравилось, а что нет, и почему Вы так считаете.